Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ312506
Length 660 bp
Fasta Format > whyf10h10
gggaagacctcctccgtccccgctcaagtctcctccgtccaccgctcctg cctcctccgtccggcgactgcgacacccctgccctcctcccttcgacgct ctgcccctccagatggggcgacgggaccggggtcgccatcctactacttc ccagatctcgtctccacccccaagatcttcaccttccgatgatgacgacg gccaggagatcatgctcctcttcgtccaagatccaagagcctcctctcct gtttgagttttgtatcacaagaaccaataccgaagaacatccatcgtttg cagtagtgtttctacctgactatcctgacctcacaacaaagccaattgat agtattatcgatgcagtgctattaagtcatcaattactaatgtactgtta gaaaacggcctttactgattgaaggagaaaattgctaccaaggagaaaac ataaggtatgtaattttgaagtactcccttcgttccgaattacttctcgc agatatggatgtatctagatgtattttagttctagatacatccattttta tgacaagtaatttggaacggagggagtaccaatttagaggtgcagttttg tgttttcttccattgggcatttttcaatttgttcatgaatttgcacatgt taactcataa
Download
page-top