Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ312504
Length 710 bp
Fasta Format > whyf10h06
gggcgtgttnatgagtgtaattggaggaacaaaaggaaaatacttggtgt catgatgaactggctcgagtgggtcctatcacagtcgcttcttcggattg cggagtgcaatccatatggcatggatgacttctggttgcagcagggcaca tcaatgctgctgagcctggtgaagagctcacaggaggatgtgcaggagcg tgcagctacaacaattgctacatttgtggttattgacgatgaaactgcga atgtggatgctgcaaggtcggaggcggtaatgcgggatggaggcattcca cttctgctggaccttgcaaggtgctcaagggtgagtgcacagtctgaagc agcaaaggctattgccaacctatcggtgaatgcaaaggttgcaaaggtgg ttgcagatgaaggaggtatcgccattttcactaatttggctaagtcgacg aatcgacttgttgctgaagaagctgctggtggcctttggaatctctccgt gggtgaggagcacaaggcggctattgcggcagctggtggtataaaggctt tggttgatcttatatttcgttggcctgctgggactgatggagttcttgaa cgtgctgctggtgcgcttgcaaacctagctgctgatgacaagtgcagcct ggaagtcgcaaaggctggtggtgtccatgctttggttacacttgctcgat catgtaaact
Download
page-top