Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ312501
Length 613 bp
Fasta Format > whyf10g22
gccaactccggctcccaacgcccaaancctccgcatccagagctccaaac cctaggcgaggcgaggcgaggcgaggcgaggaggcggcgcggcgagggag aggccatggatcccgattcggtgtcgaaggcgttcgtgcagcactactac cagacgttcgactccaaccgcgccgcgctggtggggctgtaccaggacgg ctccatgctcaccttcgagggcgagaagttcggcggccccgccgccatcg ccggcaagctcggatctctccccttccagcagtgccagcacaagatcgac accgtcgactgccagccctcggggccccagggcggcgtcctcgtcttcgt ctccggcaccatcaccaccggccccggcgagcaccccctcaagttctcac agatgttccatttgctgccagctggagggagcttctacgtgcagaacgac atgttccgcctgaactatggttaaggaagggcgactctggcagcaaagaa cttgttcagggatttatgttgaaacaatgaacatcaaatgatgatgctgc agactctttgtttgttcgccaacctgtgcaatttatcgcaaaaaattgcc ttgataggcatcc
Download
page-top