Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ312500
Length 556 bp
Fasta Format > whyf10g19
ggccagccctcgccctccaatccgcgaccgcctcgcccagatcgccgccg attcgatccggttcctcgacgggatggcgaccaagaggagcgtgggcacc ctcggggaggcggatctcaaggggaagaaggtgttcgtgcgcgccgacct caacgtgccgctcgacgacgcccagaagatcaccgacgacacccgcatcc gcgcatccatccccaccatcaagtacctcctcgagaagggcgccaaggtc atcctggccagccatctgggccgcccaaaaggtgtcacccccaagttcag cttgaagcctcttgttccacgcttgtctgagctccttggacttgaagttg tgatggcccctgactgcatcggtgaagaagttgagaaattggctgctgct ttgccagatggtggtgttctactcctagagaatgttagattctacaagga ggaagagaagaacgatcctgagtttgctaagaagcttgcatcagttgctg acctttatgtaaatgatgctttcggcactgcacatagggctcatgcttca accgag
Download
page-top