Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ312497
Length 838 bp
Fasta Format > whyf10g15
ggtcggtaaacctcttccgcgtgttgaggccaagatnattatggacgatg gtactgaaactaaaactggagtcggtgagctctgtattaaaagtccgtcc cttttcaaagagtactggaaaagaccggaggttacagcagaatcatttat tgatggtgggttcttcaagactggtgatacggtaaccgtagatgaggacg gatactttataattctagggcgcacaaatgctgatatcatgaaagttggt ggttataagttgtcagcgttagaaattgaggcggttctgttagagcatga cactgtactggagtgtgctgttcttggcttgcccgatgaagcttatgggg aggctatatgtgcaataattgtgcctaaggaggatgcaaaggaaaaggct gaacaggcttcaaagccagcactaaccttagaagcattgacaagttggtc aaaagataaacttgctccatacaagattccaacaagattgcacttatggg attctcttcctcggaatgccatgggaaaggttaacaagaaggagcttaag aaattattagaggtgtagctgtagaagtgcacgctctagccaatgcaacc aaaagaccgatctgatggaagagactaggcagcacattatacgtcaacac tccccttcacgtgtggctccttcaggcctaaacgtggatcgaaagtgggc tgcaatttaattgcgccagctgggtcttgaactcaagacctcttggctct gatatcatgtaaaagtgcatgctcttagccagtgcaatcaaaaaaccgat ttgatggaagagactaggcagcacattatacgtcaaca
Download
page-top