Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ312495
Length 519 bp
Fasta Format > whyf10g10
gaggctgagctcgattccgacgcggtcgcacctcacctggctggaacccg catcgaggtccacaccgcccgccatgagagaggaggtcaggagctcgtcg gccgcgcccgcggacccgccgctgcgctcagactcgccgcccgccacccc ggtcgccagttctgccggtgcttcatctcctcccgcgcaaacaaatgtag ctaccatagattggttaggcagcgagcagttatctaaagttgggtcatcg tcccatgttgcttcacatgctgcccagccttctcttagtactaatgctgt tggagctgctatggatttttcgcaaccatcatgtagaccatgggaacgag gagatttacttcatcgactggccacatttaagccttcaacatgggcttct aaaccaaaggctgctagttcactggcctgtgcccaaaggggctgggtgaa cattggcgttgacaaaattgaatgcgactcatgtggcgcacatctgatat ttactgcattgacatcctg
Download
page-top