Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ312492
Length 537 bp
Fasta Format > whyf10g07
agaagcttaccaatctccctttcaagcccacgaaccttcatcagctagat tagcgcagaacattcttggcctctcttcttgtctgtctctgtttcacctc atccatcgatctttagctagctgaccctcatagacccgagagcgcagatg gcaagcagatccgccgagcttctctcgaggatggccgccggcgacggcca cggcgagaactcgtcctacttcgacgggtggaaggcgtacgacatgaacc ccttccacccgcaggacaaccgcgggggcgtcatccagatgggcctcgcc gagaatcaactctcgctggacctgatcgaggagtggagcaaggcccaccc ggaggcgtccatttgcacggcggagggcgcctcgcagttcaagaggatcg ccaatttccaggactaccacggcctcccggagttcagacaggcgatggcc cagttcatggggcaggtgagggggtggaaggccaggtttgacccggatcg cgtcgtgatgagcggcggcgccaccggcgcgcaggag
Download
page-top