Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ312481
Length 663 bp
Fasta Format > whyf10f14
cattctgctcgactcagaatacaacccacacgtttcagatgctggacttg caagctttattcctgatgctgagttccagactgcggaacagagtgccggg tgcactgccccagaggtggacatgactggccagtacactatgaagagcga tgtctacagctttggggttgtcatgctagagcttttgacgggacgcaaac catttgacagctccaagcctaggtcagagcagtcactcgtgcggtgggcg tctccccagctccacgacatcgatgccctggacaggatggtggatcctgc gctcaagggtctgtaccctgccaagtccctgtcccgattcgccgacgtgc tcgccttgtgtgtccaggctgagccggaattcaggccaccaatgtctgag gtggtgcaggcgcttgtccggctggtgcagagggccaacatgacgaagaa gatgctcgacggcgacgcttcccggcgaggcgatgaccaggaccaggatt tcatatgacgcgagcacaacccttctaatatatcaccccctgatatcgca tccgagattatatttgtttatttcttctagcgcctagcctggccgagaga agagtggaggaacagagcagaattggtgtccggttctgtcagtacatatc acacaggtttcgc
Download
page-top