Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ312480
Length 434 bp
Fasta Format > whyf10f12
cgatggcttgnccgaacctgacgatcgacggggcggacgagctggcgcac ttcggcatccccgtcacgtcggacgtgcggttgccatcgcggtggcgact gagcgcggngggggtgcctgtgctgccgctgccggatgtctgctcgcacc tcttcatgcgcgccgtcaggctctaccgggcgcggntgccggtggatatg tcaggccctgaacctcgcgcatactgaagaacaagcaccagatcaagttc agacaagcaacggctaggatgaagcgatgacgtttcggagaaatcaatgg ctcggatgaatcctcgccttttaccagtagttttaaactctgtactgctt tgtaaccgtttaacgacagtaacagaaagttacagcgaggagctggacta gtatangagaaccaggtcgcgtgagggagaggct
Download
page-top