Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ312478
Length 365 bp
Fasta Format > whyf10f04
gataggagnaattgcagtatttgagaagaatatcacgaagaggggttctg ttcccgagacagtcaagaaagcaaatgattatcctgttggacctatcgtg cttggtttttttgtctttgttgttgttgggtcatctctgttccagatcat caggacagcctcaaacgccggtctcttctgagtagattggtgctatgctt atagtgaccatgaacagggctgtcatatgcagttggttgtcggtttaaaa ttagaactgaatgagatagctggtactcttgtgatgcttgttatacctct taccattgtacttggtggagtttaagttatatggaggtcatgccattgga ctgctnanaaaaaaa
Download
page-top