Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ312474
Length 669 bp
Fasta Format > whyf10e21
ggtntatgcttgtctcaaagattaagcctgcatgtgcaagtatgaaccaa tttgaactgtgaaactgcgaatggctcattaaatcagttatagtttgttt gatggtacgtgctactcggataaccgtagtaattctagagctaatacgtg caacaaaccccgacttctgggaggggcgcatttattagataaaaggctga cgcgggctctgctcgctgatccgatgattcatatccattttgtttgatgt ttggtggctgatgattaggaaactaaagtactccctccgttcgcaaatat aagtctttctagagattccaacaagtgactacataagcaaaatgagtgaa tctacactctaaaatatgtctacatacatccgaccgagggagtatagaaa aagaattgtctcatttcttatctgtgtataagaccaatgatccatatttt tatgttgttttaaaagtgttcttacctatgatgagttgcgaactgtattg cctacattgtttgaacaatctgtgagaagcttatgcagcgtctgaggatg aataagaaaaggaacaaaatctttcaaaatggatcaactttttttaattg ctattttatttttcgttttggtaatgccggattatgattactatttttat actactaaattagtttctc
Download
page-top