Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ312465
Length 581 bp
Fasta Format > whyf10e06
gggctgcaggnaattcgncacgaggctccaccgccgccaccccgtccccg catcctctcccacgcgaagaccgccgccgcccgtcaagatggtgctgcag aacgacatcgacctcctcaacccgccggcggagctcgagaagctcaagca caagaagaagcgcctcgtgcagtcccccaactccttcttcatggatgtca agtgccagggctgcttcaacataacaactgtgttcagccactctcagacc gtggtggtgtgccctggctgccagacggtgctctgccaacccaccggagg aaaagcgaggctcaccgagggatgctccttccgccggaagggcgactaag ctgcacgcctgtttatgggaaaatgaagccctgctgaaccttacttttca agtaactagttatcctgaatgtgtactggtcaaattttgttaattatgct tgcccgtttgccagcctgaacgttgtaccaacgtgttctatgtcatgcac tttttgagtggcctgttgttggtgcttctgtttgtctggctgcctggtga tatctaagtttggttcttgttaaaaaaaaaa
Download
page-top