Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ312464
Length 709 bp
Fasta Format > whyf10e04
gaggaattcggcacgagggaaagcctgccgccgagaagccgaaagctacc accatcaggaagagggcgccggctcagagcaaagggatgaagcagaaagt gatggaggaaatactcaagcctactgatgacagcaacctcagcgcgcctt ctcctgagaagaaggtgcggaggatcaggtcctcccccttcaacaagaag agcggctcgcttctgcagagggcggcgggcgcttcaacgggggcagagga tgccgaggctcctccctccggcagctctgccgagccagttgcaccgagaa ggacagtaagggagaggaaggtggcgatagtctacgccgattccgggagc gacgacgttgaggagtctgaggatgaagatgcgtcggagccgagcgaatc tgactactccgatgaggactagagtgctggactccttggctcagctgccc aaacagtgtgtggaattggagtgcagtgtgactggtttctaagacatttg gttagctgatctgatgtgttggtgcatttcttgtgcgtcttatgtttatg ttagatgtgtgtactgaggtcacaagaaggtttggaagctatgtgttgtt tgcttacagtttctccatggcttctgttcctacttagtctgtgagcttgt atcgttgttcagtctatcaatactgagagtttattatatctgtcttaaaa aaaaagggg
Download
page-top