Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ312463
Length 666 bp
Fasta Format > whyf10e03
ggnctgcaggnaattcggcacgaggnatcccgatncccgcaccgccgccc acgcatctcgagtagtttccagctcgccggagaaggagcaagaagatggc cggaaggaagggaggcgacaggaagaaggcggtgaccaggtccgtcaagg ccgggctccagttccccgtcggccgcatcgggcgctacctcaagaagggc cgctatgcccagcgcgtcggctccggcgcccccgtctacctcgccgccgt cctcgagtacctcgccgctgaggtcctggagctcgccggcaacgcggcca aggacaacaagaagacccgcatcatcccgcgccacctgctgctcgccgtc cgcaacgaccaggagctcggcaggctgctcgccggcgtcaccatcgccca cggcggcgtgatccccaacattaactccgtgctgctccccaagaagtccc ccgtcgccgccgagaaggaggccaagtcgcccaagaagaagacctccacc aagtcccccaagaagaaggtcgctgccaaggagtagccgcccccatagac tactgtcgtgacattacttaggtccatatcagggagaggatgaggagatt tggttgtttggatcctgtatgtaattgcctagttgtagtggcactttcat tggtttgatgaacggg
Download
page-top