Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ312457
Length 635 bp
Fasta Format > whyf10d12
ggcccccaggncagacaagnaagccggcggcggagaacaaggtcgagaag gcggcggagaaggcccccgcgggcaagaagcccaaggccgagaagcggct gccggcgggcaagacggcggccaaggagggcgaggcgaagacgaggggcc ggaagaagggcagcaaggccaagaagagcgtggagacgtacaagatctac atcttcaaggtgctgaagcaggtgcacccggacatcggcatctcctccaa ggccatgtccatcatgaactccttcatcaacgacatcttcgagaagctcg ccggggagtcggccaagctcgcccgctacaacaagaagccgaccattacc tcccgcgagatccagacctccgtccgcctcgtcctccccggcgagctcgc caagcacgccgtctccgagggcaccaaggccgtcaccaagttcacctcct cctagactgatgcgtccgtcgcctctagttggtatctgtatctgtagtgt cgactctgcttgtcactctgcaagtagtgctggtagtctgtgtgctgggt gctcgccaacgcttcgttggctgattggctgtaggaactgaagttgttgc atttggcagactgatatctatctagaaaaaaaaaa
Download
page-top