Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ312450
Length 524 bp
Fasta Format > whyf10c23
gtcggggcgcggcaagggcggcaaggggctcggcaagggcggcgccaagc gccaccgcaaggtcctgcgcgacaacatccagggcatcaccaagccggcg atccggaggctggcccggaggggcggcgtgaagcgcatctcggggctcat ctacgaggagacccgcggcgtgctcaagatcttcctcgagaacgtcatcc gcgacgccgtcacctacaccgagcacgcccgccggaagaccgtcaccgcc atggacgtcgtctacgcgctcaagcgccagggacgcaccctgtacggatt cggcggctgaggagccgcggcgcttgctggccggccgtggcgcacaagcc ctggctcgcggtcaagaaagtggaggagaggagaaagctgtagttgatct gggttccatgccttctatgattagtagtaatatctgtagtagcagtagct ggttgttcaatggttgcttcagtgttctgaatttctgatgggcaaacact gtgtttgccgagatatatgaatcc
Download
page-top