Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ312448
Length 365 bp
Fasta Format > whyf10c21
gcctccaccaagcagctcgggctcgagtggaccaggagctccagcatcgg cggctccttcaaggttgcgacgacgttcgatctgtccgatcaaagcaaag caccgaagctcgtagcggagagcacgtggaactatgagatctgatcgcct ccgcctccgcctgccagcgagcaagcgggagttcctgctcatagagcagc accatgtgtcatcatactgtctactacaactcaacaggcagactgcccct ctctgggtgcaccattattcggatcctattaccgctatccattttttgct tgtcgtgtgacatctgagtcgtcgctggcgatgctatgacatgaacatga ggtttaaaaaaaaaa
Download
page-top