Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ312445
Length 619 bp
Fasta Format > whyf10c12
cacgagggttcgatctgtagatcctgcgagctcggctcgtcgcgagtaac cgccgccatgtcgtcgtccgatccgtcgctggcgaccgaggcgccccagg cggccgtcaccagcgagcgcaagctcagccccgacctgcaggagcagctc gccaagccatatctggccagagcaatggcggcggttgacccgagccaccc ggagggcagcaagggtcgggacaccaaggggatgagcgtgctccagcagc acgccgccttcttcgaccgcaacggcgacggggtcatctacccatgggag accttccaaagcctccgagcaatcgggcttgggtcgccttcggccttcgg aacatccatactcctccacctcgtcctcacttatcctactcaaccgggat ggatgccttcccctctgctctcgatccatataaagaacatccacaggggc aagcacgggagcgactctgagacgtatgacactgaagggaggtttgaacc agcgaaattcgatgctatattcagcaagtttggcaaaactcggccgaatg ctttgtcagaagatgagatcaacgccatgcttaaacacaaccgcaatatg tatgatttcctgggctggg
Download
page-top