Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ312444
Length 662 bp
Fasta Format > whyf10c10
ggnctgcaggnaattcggcacgaggggagacctcatcctctgccgcctgt cgaagaacaggagggtgacgctgcaggagtttaagggcaaaacgctggtg tctatccgcgagtactacttcaaggacggcaaggaactgcccacctccaa agggatgagtatgacggtcgagcagtgggagacattcagcaaatcagtac ccgcaatagaagacgccgtcaaaacacttggagaatcagattgaaaggat gccacaaaaaccttaaaatctcgacgctcgttctggacctctgcaagtag agtagtccatgggtgctctgagtactccatggggctactagagttcatct ggacttgtataacgggcccttaaggctatggtggaccgaagtaccggacc tactgatgtgtgctgggtagacagttcatctggacgctcgttctggacct ctgcaagtagagttctcccttagtcaaggtaccggacctacctgatgtgt gctgggtagacagtttgggtgtgttcgcgaactagttctccgccggtatg gtggacccgaagtttcatcgctgtgccatgtgatctcgtgctgtttaatt gtcctttctgatatcgtaagatataacgggcccttaaggctatcgttgtg agaaaaaaaaaa
Download
page-top