Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ312442
Length 616 bp
Fasta Format > whyf10c04
gnaagtataagcctgatgggtcggtgacgttggggctctcgccatctcca tccacgcctcattcgtcgagcccaggaatgggcgcgatggttaccacacc tggctcaggatttgggccggggacagggtcagggggttctggttcaggcg cactgacggagaaacgtggcagagggcggccacctgggtccgggaagatg cagcagctggcttcgcttggaaaatggtttcttggctctgttggaacagg gtttactcctcacgtgattattatttcagccggagaggatgttgccgcca gaataatgtccttctcacaacaaggcccaagagctatttgcatcatctca gcaacaggggctgtctccacggcaacccttcatcaggattcagactccgg tgtggtgacatatgagggtcgatttgaaatcctgtgtctttctggatcat atttggtggtagaagaaggtggtacccgcactcgaagtggaggcctttgc atagctttgtgtggccctgaccacagggttatcggtgggagtgttagtgg agtcctgacagcagctggaactgttcaggtgatagtgggaagcttcatgt acggtggcgggtcaaa
Download
page-top