Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ312441
Length 659 bp
Fasta Format > whyf10c02
cacgagggtcatgccgattccttcagggagtgaactcattgttgaggtcg tgactccggtgctgcggattatgtctgagcttcagaagctttgtggggag cccactttgcctatttcgatggtgcttcccgaggagatagggtctcttgg aggggacttggcgatgccgactgcgacctcatcgttttcattggagccga gtcagccgcttgcctttgtggaccttggaggtttggcggctgctgctgct ctctcacctgaggttgttggcccggtggcgtctgttggtgctgagtttga tgaggtaggtgctttgacacctgtgtctaaggcgccgaagcccgtccagt ctctcatctttgaccgcgacgctatgttggcacgtattgatgaggtggtc ttcgcgaaaaagcttggccgcttgctcaccagcttggatgcagcttgtcc tgggtctgccaagacgattgcttgcctcctagcggaggaggtttctacgg gcaaaataaagaaggtgaagaaggctatcaggaacataggcaagaagact gacgttattaggaaggcgtccgcgactgcttaatggaggatgctcagtct ttttgtcatccatcttcgattgactcgcctctgtggatttggtggcgttc ggtggtttc
Download
page-top