Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ312433
Length 557 bp
Fasta Format > whyf10b15
tcggcacgaggcacacatccctcggnnnctaggtggatcggcgatgtcgg ggcgcggcaagggcggcaaggggctggggaagggcggcgccaagcgccac cggaaggtgctccgcgacaacatccagggcatcaccaagccggcgatccg gaggctggccaggaggggcggcgtgaagcgcatctcggggctcatctacg aggagacccgcggcgtgctcaagatcttcctcgagaacgtcatccgcgac gccgtcacctacactgagcacgctcgccgcaagaccgtcaccgccatgga cgtcgtctacgcgctcaagcgccagggccgcaccctctacggcttcggcg gctagattcgtgtcgtgtgtccgtgtgttctgtggaagacgggttttact actgctttggcgtgcgtcgttgtgttccgtcttgtgttcattaggctgta attccttgttgcggtcaatgaaactagttctgttctgaatcctgacctga agtgcaattggtttgacttagatgaaatgcaattggatgaacgatttaaa aaaaaaa
Download
page-top