Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ312430
Length 667 bp
Fasta Format > whyf10b09
tcggcacgagggttttgggactttagcctcctgcgccgccgccgccgccg cccagcgaattcgacaagcccgtgaagcccagcgccgagttcccgaacgc tgcccgctggtacgacaccgtcgccgcggctgttgcttcaaggttccctg gccagtcctctggggtgagtgcatcatcggctcctgctgcagctgctcct gccgcttccaaggatgaagatgacgatgatgacatggatctgtttggcga tgagaccgaggaggacaagaaagctgcagctgagcgtgaggctgccaagc ctgcaaagaagaaagaaagtggcaaatcctccgtcctcatggacatcaag ccatgggacgatgagactgacatgaagaagttggaggaggctgtccgcag tgttcaaatggagggtctcacctggggtgcatctaagcttatgcctgtgg gttatggcatcaagaagctccagatcatgctgacgatcatcgatgacctt gtgtccgtcgacactcttattgaggaagtgctttgcgaggcgcccatcaa cgaatatgtccagtcgtgtgacatcgttgccttcaacaagatctagaatc tttgttctcccacctgctggattcttggtactgggattggtcgatctgga aaacattatgtcgtccc
Download
page-top