Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ312428
Length 656 bp
Fasta Format > whyf10b07
ggccgcagcgccgccactccacccgcagcggcaaccatggcggtcggcaa gaacaagcgcatctccaaggggaggaagggtagcaagaagaaggccgtcg atccgttcaccaagaagcagtggtatgacatcaaggcgccgctgctgttc accagccgcaacgtcggcaagaccctcgtgtccaggacacagggtaccaa gattgcctcagagggtctgaagcacagggtgtttgaagtatctctagctg atcttcagaacgacgaggaccaggcctacaggaagatcagactccgtgct gaggatgtgcaagggatgaatgtcctcaccaacttctggggcatggactt caccactgacaagctcaggtcccttgtgaggaagtggcagacactcattg aggctcatgtggatgtgaagacaactgacaactacatgcttcgcatgttc gccattggcttcaccaagagacgcccgaaccaggtgaagcgcacttgcta tgcccaagcaagtcagatcagacagatccgccgcaagatggttgagatca tggtcaaccaagctgcaagctgtgacttgaaggagcttgtgaacaagttc atccctgaggtgatcggaaaggagattgagaaggctacctcaagcatctt ccccct
Download
page-top