Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ312423
Length 710 bp
Fasta Format > whyf10a23
aattcggcacgagggtcccccctcactcccccacgcgcgacgcgaccgct tcaatcctctcccaagggaggcgaagatgagggagatcctgcacatccag ggcgggcagtgcgggaaccagatcgggtccaagttctgggaggtggtgtg cgacgagcacggcatcgaccccacggggaggtacgtcggcacctccgacc tgcagctggagcgcgtcaacgtctactacaacgaggcctcgtgcggccgc ttcgtgccgcgcgccgtgctcatggatctcgagcccggcaccatggactc cgtgcgcacggggccatacggccagatcttccgccccgacaacttcgtct tcggccagtccggcgccggcaacaactgggccaagggccactacaccgag ggcgcggagctcatcgactccgtcctcgacgtcgtccgcaaggaggccga gaactgcgactgcctgcaaggcttccaggtgtgccactccctcggcgggg gcaccggttccggcatgggcacgctgctgatttccaagatcagggaggag tacccggaccggatgatgctcaccttctccgtgttcccatcccccaaggt gtctgacaccgtggtcgagccctacaacgccaccctctcggttcaccagc tggtggagaacgccgacgagtgcatggtgctggacaacgaggcgctctac gacatctgct
Download
page-top