Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ312422
Length 652 bp
Fasta Format > whyf10a22
ggnaagcctctagactgagctcctcatcagcgtgggacggatctctaccc gatcgtatttccagggtgacagcagggatggctaccggtagcgaagctgg aaagtctgctgaggcagtgttggaatggcctaagcaggacaaaaagagga tgctgcatgctgtttaccgtgtgggagatctcgaccgcacaattaagtgt tacacagaatgctttgggatgaagctgctgaggaaaagagatgtcccaga agagaagtacaccaatgcgtttcttggatatgggcctgaggatactaatt ttgcacttgagctgacttacaattatggtgttgacaagtatgacattgga gcgggctttggacattttgccatcgcaaatgaggatgtgtacaagctgtc tgagacaattaaatcatctgattgttgtaagatcactcgtgaacctggtc ctgtcaagggagggtccactgtgattgcctttgcacaagacccagatggt tacatgtttgagcttatccagaggggtccgacgcctgagcctctctgtca agttatgcttcgtgttggtgaccttgatcgggctatcatgttctacgaga aggcccttgggatgaagcttctgaggaagaaggatgtgcctcagtataag ta
Download
page-top