Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ312420
Length 607 bp
Fasta Format > whyf10a19
aggctcctccagcccgaactccggcgactccaccaccagccccccgagca gcccgccctctccgaccaccgccatgtcgaggcgcggcgactgggtctac gagaacaacggcgggacctgcgtggccatcgccggcgcggactactgcgt ggtcgccgccgacacccgcctctccgtcggatacaacatcctcacgcgcg agcactccaagatctgcgagctggccgataaatgtgtaatagcatcttct ggcttccaaggtgacatcaaagctctacagaagaacttagctgccagaga actgctataccagcaccagcacaataaaaggatgagctgcccagcaatgg cacaattgctctccaacaccctgtactacaagagattcttcccatactat gctttcaacgtgcttggtgggcttgacagtgaagggaaaggatgtgtcta ctcctatgatgctgttgggtcctatgaaaggactggttacagtgctcagg gatcagggtctaccttgatcatgccagtgctggacaaccagctgaaatca cctagtccactattagtccctgcaagagatgccgtcacccctttgtccga gtcagag
Download
page-top