Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ310962
Length 614 bp
Fasta Format > rwhyd9k06
cacacgacgacagcagtgatgctgcctacaacaatggttctgaggtctgc atcataaacatacgtttgcttcatcgcaaaccagaaggaacatcatcaca tatcaagttcgtcttactccaacaaccatatttcttctacacagaagaag atagacctagcacggcaattaggaacaaactacaaccggaagcaacacat tccacttccgatccactaacggcgttgacggggaggacggcttaggccct ctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtga cgcgcttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacg aggtacgcctcggccgcctcctggagggccagcacggcgtgggactggaa gcggaggtcggtcttgaagtcctgcgcgatctcgcggaccaggcgctgga acggcagcttgcggatcagcagctccgtgctcttctggtacttgcggatc tcccggagggcgacggtcccgggcctgtagcggtggggcttcttcactcc gcccggtggtcggcgccgacttcctcgccgccttggtggcgagctgcttg cggggcgccttgcc
Download
page-top