Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

This sequence is the data used during the creation of complex contig (registered : 2012 - ), before an accession number is assigned.

Fasta Format

Accession HX030218
Length 508 bp
Fasta Format > whxl_8015_a02f
TACGCTATTGGAGCTGGAATTACCGCGGCTGCTGGCACCAGACTTGCCCT CCAATGGATCCTCGTTAAGGGATTTAGATTGTACTCATTCCCAACACAGC ACAAACACAAACCAATCGAGATCCAAAGCAACCAAGAGCAATGGCGGGCG AGAAGGGGCTGGTGCTGCTGGACTTCTGGGTGAGCCCGTTCGGGCAGCGC GTCCGCATCGCGCTGGCCGAGAAGGGCCTGCCCTACGAGTACGTGGAGGA GGACCTGATGGCCGGCAAGAGCGACCGCCTCCTCCGCTCCAACCCGGTGC ACAAGAAGATCCCGGTGCTCCTCCACGACGGCCGCCCCGTCAACGAGTCC CTCATCATCCTCCAGTACCTCGAGGACGCCTTCCCGGACGCCCCGGCCCT CCTCCCCTCCGACCCCTACGCGCGCGCGCAGGCCCGCTTCTGGGCCGACT ACGTCGACAAGNAGGTCTACGACTGCGGCTCCCGGCTCTGGAAGCTCAAG GGCGAGCC
Download
page-top