Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ306745
Length 396 bp
Fasta Format > rwhyd5b17
aaacgcacgacagagaagtacatcccatccaccacggcacatataacaca gaaaaacacggccgccaccagcagagcacaccacgtatctactagcctcc gaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtcca tggctgtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcg cggatgacgttctcgaggaagatcttgaggacgccgcgggtctcctcgta gatgaggccggagatgcgcttcacgccgcccctcctcgccagcctccgga tcgccggcttggtgatgccctggatgttgtcgcggaggaccttccggtgg cgcttggcgccgcccttgcccagccccttgcctcccttgccgcgcc
Download
page-top