Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ306645
Length 600 bp
Fasta Format > rwhyd4j09
gtgatgctgcctacaacaatggttctgaggtctgcatcataaacatacgt ttgcttcatcgcaaaccagaaggaacatcatcacatatcaagttcgtctt actccaacaaccatatttcttctacacagaagaagatagacctagcacgg caattaggaacaaactacaaccggaagcaacacattccacttccgatcca ctaacggcgttgacggggaggacggcttaggccctctcgccacggatgcg gcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtgga tggcgcacaggttggtgtcctcgaacagcccgacgaggtacgcctcggcc gcctcctggagggccagcacggcgtgggactggaagcggaggtcggtctt gaagtcctgcgcgatctcgcggaccaggcgctggaacggcagcttgcgga tcagcagctccgtgctcttctggtacttgcggatctcccggagggcgacg gtcccgggcctgtagcggtggggcttcttcactccgccggtggtcggcgc cgacttcctcgccgccttggtggcgagctgcttgcggggcgccttgccgc
Download
page-top