Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

This sequence is the data used during the creation of complex contig (registered : 2012 - ), before an accession number is assigned.

Fasta Format

Accession HX020524
Length 330 bp
Fasta Format > whxk_10016_b03r
GCGCAGCCAGCGAGAGGTCATCTCGCTCGCTCGATCATGGTACAAATAAA CACACAAAGTACGTGCAGCTACACGTTGATCCACGACGTACAAGTACACA TGCATATCTCGTCCGATGGACGGACAGATGGCTTAACACATTTAGNTTCC GGGGGCGAAGTTGGTGGCGAAGGCCCACGCGTTGTTGTTGACCGGGTCGG CGACGTGGTCGAAGAGGTTCTCTACGGGCCCCTTTCNNGTGACGATGGCC TGCACGAAGAAGCCGAACATNGAGAACATGGCGAGGCGGCCGTTCTTGAG CTCCTTGACCTTGAGCTCAGCTGCGGTGTC
Download
page-top