Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ311109
Length 662 bp
Fasta Format > rwhyd26f01
ttatttatcntcatacgacaaaaggttcacaccacaattcatgcaccctt gcttgcaccagaacacgcacataacacccacacacacaagccaggcaagg gacagtccacgcagagtgcacgcttgcgacaaccagagcacatcaaggct cgaattattccaacctagacagggcctactgctgcccatcactaccgaca caatgggggtgggtcgggtctccaagcggcgggagggcttacgggttcac tttcggcgcccacccggcgatcaggttctccttggtcgccttggtcttga cgaacgactcgcggctgaagagagcctcggtgtaggcatggacgctggtc agggtttcagggaccttccagcccttgaagtgctccagggcgacctggag gtggtagagcttcggagccaggctgagatcgacggcggagatgttcgccc cgttgatgtagggtccatgggccttcaggtgctcttcgagtgcctgcagc tcgtcaacaagtgccttctccgaaccatcgctggcatccttgctcttcaa gaacgtgacgaaggtggagaagatctttgatcccactgatgcatactcag gaggggtcacaagtgatggagttgggtacttctcctcaatgacttgagtg atcacatcagaa
Download
page-top