Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ312147
Length 242 bp
Fasta Format > rwhyd24e21
cacatatcaagttcgtcttnctccaacaactcatatttcttctacacagn aaggaagatagacctagcacggcaattaggaacaaactacaactcggang caacacattccagttccgatccactaacggcgttgacggggaggacggct taggccctctcgccacggatgcggcgggcgagctggnatgtccttgggca tgatggtgacgcgcttggcgtggatggcgcacaggttggtgt
Download
page-top