Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ310220
Length 371 bp
Fasta Format > rwhyd23f03
atacgtttgcttatcgcaaacngaaggaacatcatcacatatcaagttcg tcttactccaacaaccatatttcttctacacagaagaagatagacctagc acggcaattaggaacaaactacaaccggaagcaacacattccacttccga tccactaacggcgttgacggggaggacggcttaggccctctcgccacgga tgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcg tggatggcgcacaggttggtgtcctcgaacagcccgacgaggtacgcctc ggccgcctcctggagggccagcacggcgtgggactggaagcggaggtcgg tcttgaagtcctgcgcgatct
Download
page-top