Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ309638
Length 786 bp
Fasta Format > rwhyd20p20
gcatgcatattaaccaggtgcaaagcaggttcaaagatacaaggttctta caacacaacaggttgtaaaacaaacaccacaaagcaaacgttcaaacaga cagataacagataaagccactcgggcagatcataggatagcagtagcaag ccttgggaaagcaccaggaggcaggcttaatactcatcgccctcatcacc gtcctcaccctcgtcgaactcagcaccaacttcttcatagtccttctcca gggcagcgagatcctcacgggcctcagagaactctccctcctccatgccc tcaccgacgtaccagtggacgaaggcacgcttggcgtacatcaggtcaaa cttgtggtcgatgcgggagaagacctcgacgacactggtggagttggaga tcatgcacacagccctctggaccttggcaaggtcaccgcctgggacgaca cctggtggctggtagttgataccacacttgaagccagtggggcaccagtc aacaaactgaatagtgcgcttggtcttgatggtggccacagcagcgttga cgtcctttggcacaacatcaccacggtacatgagacagcaggccatgtac ttgccgtggcgggggtcgcacttggccatcatggacgaaggctcaaaggc gctgttggtgatctcagcaacggacagctgctcatggtaagccttctcag ctgagatcactggggcataggaggaaagcatgaagtggatcctcgggtag ggcaccaagttggtctggaattcattgacatcaaca
Download
page-top