Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

This sequence is the data used during the creation of complex contig (registered : 2012 - ), before an accession number is assigned.

Fasta Format

Accession HX000015
Length 369 bp
Fasta Format > whxi_12015_a01r
GCCTCCTGCGCCCAACTAACATACAACTACTAAATATCTTCAATTTCAAC ATCANNGTCAGTCCTGCCATGGCATTGCTTGCATCAACTTCCTCCTAACA CCCGGGCACCAAGAATGCCCAGCCCACTACCAAAACAACGCCTCCCTCTC CCTGCCACCCCAACTCATCATGCAGGTGCTATTTACATATACAGATTACA ACAGACGCCGTCGCCTAAATTCAGAAGGACCAAACAGACGAAGAAGAGAC TAAAGCACCACCTGCCTAGTTCCTCATCTAACAGGAAGATGGATCCTACC AAGGAAAACCTCGTGTCACAAATGGTCCCCCGGTTACCGGTTGTTCTGGG GACAAACAAAATAAGCCGA
Download
page-top