Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ306090
Length 520 bp
Fasta Format > rwhyd1e22
cataagtagattaacatgcattnagaaatgaaactgcaaatgggtatcaa atgtttcacaatctctgatgtcacggcggcagaaggatttcaagtactct aaaacatttagctagaagggactaaaccattgatcataaccaccaacaaa aatattttccttgtttacagaacaccatcgcacttcgcacttctgtttca aacagattactttgaggtcgtcttgtccttggtcttctgtattttcaaca ccttcttcacgatcttctgctcctcaaccaagaaagcgcggatgatcctt tccctcactgcagttccagagagcactccaccatagggacggttcacagt cctgcggttcctagacaaccttgatcttttgtattcagtaggcctgaggt ggggaatcccctggatcttcttcccggtcacagggcacttggggccgctc gccctcttcttggtgtactggtacactagcttaccacctggggtcttgac gacccgcgtctggttggacc
Download
page-top