Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ306072
Length 470 bp
Fasta Format > rwhyd1c19
tttaagcttctttncacaaaacctaatgaagcactgtagtttacacttca cttatttcgcctgactgtattcacaagatatgacgctattcatgataaaa ctacacaaacgtccacaaattgacagctcggaacagacgcatcaatcatt ccttgggcacttacgaggtgattgaaaaaggtcacaaatgaaatacgggc ccacaagtcaccatggaaatacagtaatgtcaaaggaatagctgacagtt gtggcctcaggttctaacagcatcctgatgatccttgaccccggttgcca cccaccacgtccacggtgtccggcatatacagttcttcctctggctcgtt cttcagagcgttctttactatacactggaaagcttcctccacgttgattc catccttggcagaagtctcaaagtatgggatgttccctttagaggcacac catgccttcgcctttttctc
Download
page-top