Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ309085
Length 680 bp
Fasta Format > rwhyd18l04
ttaagcttctttncacaaaacctaatgaagcaactgtagtttacacttca cttatttcgcctgactgtattcacaagatatgacgctattcatgataaaa ctacacaaacgtccacaaattgacagctcggaacagacgcatcaatcatt ccttgggcacttacgaggtgattgaaaaaggtcacaaatgaaatacgggc ccacaagtcaccatggaaatacagtaatgtcaaaggaatagctgacagtt gtggcctcaggttctaacagcatcctgatgatccttgaccccggttgcca cccaccacgtccacggtgtccggcatatacagttcttcctctggctcgtt cttcagagcgttctttactatacactggaaagcttcctccacgttgattc catccttggcagaagtctcaaagtatgggatgttccctttagaggcacac catgccttcgcctttttctcagaaaccacgcgactattcccgccatctac atcaactttgttacccagcagaacaaaagggaagttatcaggatctgatg ggctagcctgaattagaaactcttcacgccagttgttcagattatcaaat gatttcattgagttaacatcgtaaactagaacacaacaatctgcaccgcg gtagaatgcaacaccaagactttgaaacct
Download
page-top