Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ651979
Length 626 bp
Fasta Format > whem7e15
agcagagagaggaggaggaggaggaggaggaggagaccatgtcgtcgtcc ggtggcaagctcttcaccctggaggaggtcgccaagcacagctccaagga cgactgctggctcgtcatcggcggcaaggtgtacaatgtgaccaagtttc ttgatgaccaccctggaggcgacgacgtcttgctgtcttcaactgccaag gacgcgaccgacgacttcgaggacgtgggacacagcacaaccgcccgggc gatgatggacgagtactacgtcggcgagatcgacgcgaccacgataccca ccaaggtcaagtacacgccgcccaagcagccgcactacaaccaggacaag acccccgagttcgtcatcaagatcctccagttcttggtccccctcgcgat actgggcctggccgtcgccgtacggatctacaccaaggcagactctgtct agcaccgtcatcttataccagtcagtcagtcattcggaagtgtccaagag ctgaataagttttantggggatttgcatattttgtaccancgtcaccgtc ctgtcatggaatctgggaactgctctcnacccntcnttgcnttatggttc tactaanacntccnctgttnaaaaaa
Download
page-top