Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ619450
Length 684 bp
Fasta Format > rwhvh1k04
tggacatacacatattcttaggaacaaataagaaagataaatggagaagg aaaacccaaagcaatgtcagagttgacaaaactgcaatggcactttatat atggcctgtcgtgagtgagctgtttaggccttgccggactcctcgcagcc cggtggcttgaaggcgatgaagctgacgcactgcacctgacgcatgttgt cgaatccgatgatgcggacatacgcgtcagggtactccttcttgacctcc tccacctcgttgatcacctgtgtggcgtcagtgcacccgaacataggcag cttccacattgtccaataccggccatcgtagtacccaggagatgcgttgt gctcacggaagatgaacccaaccttgctgaactcgaggcaaggcacccac ttggagcggatcaggtagtcgacctgcttgaggagggcctccgtgctgag cggtggcaggtaagacagggtctcgaacttcttgatgccctcgatgggcc acacctgcatgcacctgatccttccaccgttgctgacgctgccgaggcta gcgccgttggagcggcggctgacggggaggccggcggtggacttgagccc ctggaaaggagcgacggangtggccgacnangccatcacggtgggggcca tggctgtactatgtangtatatancttgctanga
Download
page-top