Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ694629
Length 411 bp
Fasta Format > whsc17o02
caaagccagtacgtagcgcaagcagagtttagctcgctcccagcccggcc gctcaccatgtggaccaagaaggtggcgacgcaggtggttttggtcctgc ttctcctcctcatcgcacaggaggcggcggtgccgggggcggaggcgaag atctgccggcagcgcagcgcggggttcaaggggccatgcgtgtcggacaa gaactgcgcgcaggtctgcctgcaggaacgctggggcggcggcaactgcg acgggcccctccgccggtgcaagtgcatcaggcagtgctgatcatatgtg gaatgctacggctagctggccctcnccgtacgtcagctagctagcccatg gagccatacgtctgtgtacctacttgaatgtgtgtgtgtgtgtgtgtgcc cccttatacgt
Download
page-top