Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download  -------------------------- How to Order Resources MTA Sample

cDNA

Fasta Format

Accession CJ521851
Length 869 bp
Fasta Format > rwhcs3n10
gctgtaatgaaattgtgcaatagtgcacatgcagacagaaaatgagaaac ataggatgccggtatgagtttaaaacttgtaagaaacccagccggggttt tgttacatgtcactttcaaggtgaaacaggcccttcacgaaagagctttc tgcagctcggcggtcacttcctttggtggtttctccgcatgaagatttgc cactaagccattcttggagtagtagtcaatcacaggttcagtttgtatgt ggaaagcttcaagccttgacttcaagacctcagctgtgtcatcttttctt tgaattaagggttctcccgaaacatcatcaactcccggagtcttgggagg agcaaattttgtatggtaagatctaccactcgatgggtgtatccaacggc cagtaattcgttcttccaatattgcatcatcaattgcaaaatttagaacc ttgtcaaccttagcaccttgctttgcgagcatttcatcgagcttttgtgc ttgaacaacagttctagggaagccatcaaggataaaacctttttgacatg aaggttttttcatggcttcatcaataatcccaacaaccaagtcatctgaa acaagctctcccttgtccatagcttctttagccttgatacccagaggagt cttagcggcgacagcagccctcagcatatcgccagtggctaaatggcaca aacaatattcatccttaataaggggagactgtgttccctttccagagcca ggtggaccgacgaggatgatgcgcttgtcgggcttggagctgcacttggc gcgacggagcagctcggtcatgagctccaccgaaggcacgtcctcnatgn tcgtcgccatctcttcctc
Download
page-top