Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ646618
Length 504 bp
Fasta Format > whei5i23
aatccggcaaggttcccgacccggagtccaccgacaaccccgagttcaag atcgtcctcaccatcatccgcgacgggctcaagaccgacgccagcaagta ccgcaagatgaaggagaggctcgtcggtgtctccgaggagaccaccaccg gcgtcaagaggctctaccagatgcaggagtccggcaccctcctcttcccc gccatcaacgtcaacgactccgtcaccaagagcaagtttgacaaccttta cggttgccgtcactcgctccctgatggtcttatgagggccactgatgtta tgatcgccggcaaggtcgccgtggtctgcggttacggtgatgttggcaag ggctgtgccgccgcactcaagcaggctggtgcccgtgtgatcgtgacaga gattgaccccatctgtgcccttcangccctgatgganggtatccanatcc tcaccttggaggatgttgtctctnangntgacatntttgtgacnannann nnna
Download
page-top