Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ642489
Length 669 bp
Fasta Format > whec9f10
tcctcttcccgccatcaacgtcaacgactccgtcaccaagagcaagtttg acaacctttacggttgccgtcactcgctccctgatggtcttatgagggcc actgatgttatgatcgccggcaaggtcgccgtggtctgcggttacggtga tgttggcaagggctgtgccgccgcactcaagcaggctggtgcccgtgtga tcgtgacagagattgaccccatctgtgcccttcaggccctgatggagggt atccagatcctcaccttggaggatgttgtctctgaggctgacatctttgt gaccaccaccggaaacaaggacatcatcatggtcgaccacatgaggaaga tgaagaacaacgccattgtctgcaacattggtcactttgacaatgagatc gacatgaacggccttgagacctaccctggtgtcaagcgcatcaccatcaa gccccagactgaccgttgggtcttccccgagaccaagactggcatcattg ttcttgctgagggtcgtctgatgaaccttggatgtgccactggccacccc agctttgtcatgtcctgctcattcaccaaccaggttattgctcancttga gttgtggaacganaaggccagtggcaagtatganaanaaggtgtacgttc tccccaagcacctggacga
Download
page-top