Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ596487
Length 683 bp
Fasta Format > rwhsd8i22
attagatatgtatgtctgaacattcaccagcgatatggaaaatatagcca agtatctatccgtttttcccgagtcacgattcaacagcggacgtcttagt agaaccataacgcaacgacgggtcgagagcagttcccagattccatgaca ggacggtgacgctggtacaaaatatgcaaatccccactaaaacttattca gctcttggacacttccgaatgactgactgactggtataagatgacggtgc tagacagagtctgccttggtgtagatccgtacggcgacggccaggcccag tatcgcgagggggaccaagaactggaggatcttgatgacgaactcggggg tcttgtcctggttgtagtgcggctgcttgggcggcgtgtacttgaccttg gtgggtatcgtggtcgcgtcgatctcgccgacgtagtactcgtccatcat cgcccgggcggttgtgctgtgtcccacgtcctcgaagtcgtcggtcgcgt ccttggcagttgaagacagcaagacgtcgtcgcctccagggtggtcatca agaaacttggtcacattgtacaccttgccgccgatgacgagccagcagtc gtccttggagctgtgcttggcgacctcctccagggtgaagagcttgccac cggacgacgacatggtctcctcctcctcctccc
Download
page-top