Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ660592
Length 418 bp
Fasta Format > whhg5b02
ctcccatgggtggcttccctcactatggtgtggtgaaggctgactacctg atgatcaagggatgctgtgtcggccccaagaagcgggtggtgaccctccg ccagtccctgctgaagcagacctctcgtctggccctggaggagatcaagc tcaagttcgtcgacacctcttccaagtttgggcacggtcgcttccagacc acggacgagaagcagaggttctacggcaagctcaaggcttgagctgctgc cccgcatcatcagttgtatcattttgtcaaaacgaacatgtgatacttgg ttacttcccctgcctaagttttgtactaggtgatgttttcagaatctggc tcatctatgaattcttcgtgtcatgtgctactgttattgtgatttagctg ttgaaaccaaaaaaaaaa
Download
page-top