Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ641332
Length 611 bp
Fasta Format > whec4l05
aggaggaggaggagaccatgtcgtcgtccggtggcaagctcttcaccctg gaggaggtcgccaagcacagctccaaggacgactgctggctcgtcatcgg cggcaaggtgtacaatgtgaccaagtttcttgatgaccaccctggaggcg acgacgtcttgctgtcttcaactgccaaggacgcgaccgacgacttcgag gacgtgggacacagcacaaccgcccgggcgatgatggacgagtactacgt cggcgagatcgacgcgaccacgatacccaccaaggtcaagtacacgccgc ccaagcagccgcactacaaccaggacaagacccccgagttcgtcatcaag atcctccagttcttggtccccctcgcgatactgggcctggccgtcgccgt acggatctacaccaaggcagactctgtctagcaccgtcatcttataccag tcagtcagtcattcggaagtgtccaagagctgaataagttttagtgggga tttgcatattttgtaccagcgtcaccgtcctgtcatggaatctgggaact gctctcgacccgtcgttgcgttatggttctactaagacgtccgctgttga atcntgactcg
Download
page-top