Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

This sequence is the data used during the creation of complex contig (registered : 2012 - ), before an accession number is assigned.

Fasta Format

Clone name whdl_26034_b15f
Length 506 bp
Fasta Format > whdl_26034_b15f
ACCCGATCCGATCTCCCCCCTCCTCCGTCGCCATGGGCCGCAAGTTCTTC GTCGGCGGCAACTGGAAATGCAATGGAACTGTGGAACAGGTAGAGAGTAT CGTCAACACTCTGAACGCTGGACAGATCGCCTCTACGGATGTTGTCGAGG TTGTCGTCAGCCCGCCCTATGTCTTCCTTCCCACCGTCAAGGGTAAGCTG CGCCCAGAGATCCAAGTCGCTGCTCAGAACTGCTGGGTGAAGAAGGGCGG TGCTTTCACCGGTGAAGTCAGTGCTGAGATGCTTGTCAACCTCGGCGTTC CCTGGGTCATCCTTGGACACTCTGAAAGGAGGAGCTTGATGGGAGAATCA AGCGAGTTTGTTGGAGAGAAGGTTGCATATGCACTTGCTCAGGGCTTGAA GGTCATTGCATGTGTTGGTGAGACTCTCGAGCAGCGAGAAGCTGGATCAA CCATGGCAGTTGTCGCTGAACAGACAAAAGCAATTGCTGGCAAGATCAAG GACTGG
Download
page-top